rs665095 chr11:69515381 T>C
- Sequence
tacaggagacctgcacaggtgccc[T/C]gagctggcatgactccgcccatgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.94 | 0.24 | 1.47 | n/a | No Hit | |||
| FOXA1_HUMAN | 1.03 | 0.15 | 1.54 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, microalbuminuria, multiple myeloma