rs66517027 chr1:229157216 A>G
- Sequence
cagacaaccataacacagagtgac[A/G]gatgcagaaggcaggcagggtgag
- ASB in cell types
- foreskin keratinocyte VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.73 | -1.16 | 2.75 | |||
| VCaP (prostate carcinoma) | 2.08 | -2.91 | 2.00 |
Items per page:
1 – 2 of 2