rs66607339 chr14:101815126 C>T
- Sequence
gcccaacactgtgaggcattataa[C/T]cctcccccactcactaccgcccct
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | -0.10 | 1.70 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Skin_Sun_Exposed_Lower_leg, Whole_Blood