rs6669244 chr1:20508296 T>C
- Sequence
ccccagccgggtgtcggagagcga[T/C]tggggagctgagcgaccacccacc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 0.72 | 0.21 | 1.38 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), college completion, diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, homa-b, homa-ir, triglycerides, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid