rs667172 chr3:107628126 G>A
- Sequence
agtagactatcttgatttatcatg[G/A]tatttataagtatttggccactgg
- ASB in cell types
- VCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.72 | 0.50 | 1.53 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, rheumatoid arthritis, serum creatinine, total cholesterol change with statins, triglycerides, waist hip ratio