rs667745 chr1:244329609 G>A
- Sequence
gttggggttctatcaatatcaatt[G/A]aggtggtttgtaatgttgtttaga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.50 | 0.60 | 2.57 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), total cholesterol, total cholesterol change with statins, triglycerides change with statins