rs6692382 chr1:160581802 G>A
- Sequence
taatctttctagactttcatgatg[G/A]ccctctcctggggttgtcttccta
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.22 | 0.63 | 2.06 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, hypertension (early onset hypertension), maternal transmission distortion, transmission distortion, triglycerides
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Nerve_Tibial, Stomach