rs6695161 chr1:40939992 G>T
- Sequence
agttcaaagtccacttacatcatt[G/T]caagcaatttcattcattcatgcc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | 1.33 | -0.35 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1