rs669631 chr19:6633609 T>C
- Sequence
gatattcatatataatcatatcca[T/C]gatctatgtctagtataagtattc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.24 | 0.64 | 2.00 | |||
| foreskin keratinocyte | 1.77 | -2.19 | 2.33 |
Items per page:
1 – 2 of 2