rs669838 chr18:11994599 C>A
- Sequence
gagtgtataaataccagtgagctt[C/A]gataaggtgacacaaaaggacata
- ASB in cell types
- PC3 (prostate carcinoma) liver LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN RXRA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.99 | 1.75 | 1.50 | n/a | No Hit | |||
| RXRA_HUMAN | n/a | 1.66 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, homa-b, obesity with early age of onset (age >2), systolic blood pressure (sbp), triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Testis, Thyroid