rs67064196 chr1:244815769 A>C
- Sequence
tttagcatatcatcaagaaataac[A/C]atgacaatgggcaacccgcagccc
- ASB in cell types
- GM12878 (female B-cells) HUES64 (embryonic stem cells)
- ASB for transcription factors
- NANOG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NANOG_HUMAN | 2.21 | -2.25 | 1.33 | 2.31 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
