rs671151 chr5:10320992 A>G
- Sequence
ggggaagtccactcccccaccccc[A/G]tgatccaatcacctcccaccaggc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | -0.34 | 0.82 | 1.22 | 1.42 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood