rs6711606 chr2:101305708 T>G
- Sequence
cacatacatggggtgaggggggta[T/G]gaacagggagggagagggagagga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.30 | 0.82 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, college completion, eye color, fasting blood glucose, neuroblastoma (brain cancer), pancreatic cancer, serum creatinine, years of education
PheWAS abnormal findings on exam of gastrointestinal tract/abdominal area, abnormal findings on radiological examination intrathoracic organs, abnormal results of function studies, adverse effects of sedatives or other central nervous system depressants and anesthetics, aseptic necrosis of bone, cervical radiculitis, cns infection and poliomyelitis, conjunctivitis, infectious, derangement of joint, non-traumatic, dermatomycoses, deviated nasal septum, disorders of cervical region, disorders of penis, disorders of synovium, tendon, and bursa, disorders of the globe, diverticulitis, facial nerve disorders, fasciitis, fracture of neck of femur, glomerulonephritis, gram positive septicemia, hallux rigidus, impaction of intestine, infection of the eye, light-headedness and vertigo, lung involvement in conditions classified elsewhere, lyme disease, mechanical complications of cardiac/vascular device, implant, and graft, mental disorders due to brain damage, mitral stenosis/insufficiency, myalgia and myositis nos, myopia, nasal polyps, open wound of lip and mouth, open wounds of extremities, osteoarthrosis of multiple sites, osteoarthrosis, generalized, other abnormality of urination, other arthropathies, other benign neoplasm of connective and other soft tissue, other biliary tract disease, other cardiac conduction disorders, other derangement of joint, other disorders of urethra and urinary tract, other specified nonpsychotic and/or transient mental disorders, paroxysmal supraventricular tachycardia, pelvic peritoneal adhesions, female (postoperative) (postinfection), periostitis, peripheral angiopathy in diseases classified elsewhere, pneumonitis due to inhalation of food or vomitus, poisoning by agents affecting the cardiovascular system, poisoning by other anti-infectives, retinoschisis and retinal cysts, sarcoidosis, secondary malignancy of bone, shock, spirochetal infection, sulfonamides, swelling of limb, tinnitus, torticollis, vascular dementia, vertiginous syndromes and other disorders of vestibular system, viral pneumonia