rs671192 chr6:157667332 A>G
- Sequence
cacagccaccaaattgtaagagag[A/G]aaaagcgagcggtgatgtctccct
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) GM12878 (female B-cells) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.33 | 0.85 | 2.01 | |||
| K562 (myelogenous leukemia) | 0.45 | 0.63 | 1.33 | |||
| GM12878 (female B-cells) | 0.43 | 0.80 | 1.37 | |||
| epidermal keratinocytes | 1.82 | n/a | 2.00 | |||
| foreskin keratinocyte | n/a | 0.24 | 2.67 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, serum creatinine, years of education