rs6730027 chr2:197012205 T>C
- Sequence
ttttagtgaatgacaggaggaaaa[T/C]ccaagctgactgagtcttcttgac
- ASB in cell types
- CD34+ stem cells-derived erythroblasts erythroid progenitors liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | n/a | 2.42 | 2.00 | |||
| erythroid progenitors | n/a | 2.35 | 2.50 | |||
| liver | n/a | 1.85 | 2.50 |
Items per page:
1 – 3 of 3