rs6738087 chr2:65365191 T>C
- Sequence
cacatatttcaaatactgttcttc[T/C]tcattattgtcctctaccataatt
- ASB in cell types
- germinal center B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center B-cells | -0.70 | 1.18 | 2.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), aortic valve calcium, college completion, platelet rich plasma (prp) platelet adp, primary rhegmatogenous retinal detachment, rheumatoid arthritis, salmonella-induced pyroptosis, sporadic creutzfeldt-jakob disease