rs6751710 chr2:168118795 G>A
- Sequence
cggctgcaaggctttttacagact[G/A]gtaagcaattcctgtccagattct
- ASB in cell types
- A549 (lung carcinoma) H1 (embryonic stem cells) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.12 | 0.94 | 2.08 | |||
| H1 (embryonic stem cells) | 1.87 | -0.38 | 1.56 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | n/a | 2.22 | 2.00 |
Items per page:
1 – 3 of 3