rs675436 chr15:101652337 T>G
- Sequence
cgcgacacaaggcgcggaggcccc[T/G]cagcgggagcacccctcccgccat
- ASB in cell types
- A549 (lung carcinoma) SK-N-SH (neuroblastoma) liver erythroid cells
- ASB for transcription factors
- TYY1_HUMAN RAD21_HUMAN GABPA_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 1.66 | 0.29 | 1.17 | n/a | No Hit | |||
| RAD21_HUMAN | 0.92 | 0.27 | 1.23 | n/a | n/a | |||
| GABPA_HUMAN | 1.21 | 0.07 | 1.39 | n/a | No Hit | |||
| FLI1_HUMAN | 1.52 | -0.59 | 1.44 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood