rs676277 chr20:10558891 G>C
- Sequence
actggtgtctatcacactgcactt[G/C]gtctaccttgcattcgtcaaactg
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- TBX3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX3_HUMAN | 0.24 | 1.89 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi) in type 2 diabetes, ldl cholesterol, obesity with early age of onset (age >2), paternal transmission distortion, refractive error, serum creatinine, total cholesterol, transmission distortion, weight in type 2 diabetes
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid