rs6764 chr14:58427073 T>G
- Sequence
catacttaagcacaggctctcgca[T/G]ccgacatcagtacaaggctggggg
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) GM12878 (female B-cells)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 0.32 | 1.82 | 1.61 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in nonasthmatic participants >=30 years old), decrease in fev1 (in nonasthmatic participants), ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid