rs67651814 chr20:44969513 G>C
- Sequence
ttcgtgagtttgacatttgtgtgt[G/C]tgtgtgattaagtgatgacagatt
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.72 | -0.17 | 2.04 | |||
| GM12878 (female B-cells) | 0.53 | 0.42 | 1.38 |
Items per page:
1 – 2 of 2