rs67700546 chr17:66304963 C>T
- Sequence
gtaggagagttagaaagggacttg[C/T]agcatactgaggctagctattgtc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.01 | 0.71 | 1.69 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood