rs6772217 chr3:187288620 T>C
- Sequence
acattagttataattattccatcc[T/C]gccagttcccaaaaagcaagagtc
- ASB in cell types
- periferal blood macrophages macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.80 | -0.77 | 2.00 | |||
| macrophages | 1.78 | n/a | 2.50 |
Items per page:
1 – 2 of 2