rs678634 chr20:49793866 G>A
- Sequence
gctgccacacccaactttgcatat[G/A]ttgaagcttctctagggtgaatac
- ASB in cell types
- monocyte-derived dendritic cells monocyte-derived macrophages HT29 (colon adenocarcinoma)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.90 | 0.13 | 2.04 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP major depressive disorder (narrow definition), major depressive disorder (narrow definition) (males), recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (males), rheumatoid arthritis, tetrology of fallot, transmission distortion, variant creutzfeldt-jakob disease