rs6789167 chr3:171168382 C>T
- Sequence
gagatacaggagtggatcccagga[C/T]tgagcctttgcccggcagtccctg
- ASB in cell types
- foreskin keratinocyte SUM159PT (pleiomorphic breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.14 | 2.14 | 2.17 | |||
| SUM159PT (pleiomorphic breast carcinoma) | -1.35 | 1.69 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, infant head circumference, ldl cholesterol, triglycerides change with statins