rs679625 chr11:58880758 T>C
- Sequence
cagttctatttactaaaatttcct[T/C]gagtattcaaacattctgaaattc
- ASB in cell types
- liver HepG2 (hepatoblastoma)
- ASB for transcription factors
- BCL6_HUMAN HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BCL6_HUMAN | -2.23 | 2.28 | 1.33 | n/a | No Hit | |||
| HNF4A_HUMAN | 2.03 | -1.84 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), hdl cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Kidney_Cortex, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis