rs6799179 chr3:12787596 A>C
- Sequence
attgatgttcagcagggtctcgta[A/C]tcctgggcctggctgtccctctgc
- ASB in cell types
- heart left ventricle LNCaP (prostate carcinoma) adrenal gland gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.07 | 2.28 | 1.40 | n/a | No Hit | |||
| RAD21_HUMAN | -0.17 | 1.54 | 1.39 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid