rs6802284 chr3:176881114 T>G
- Sequence
aaatgacaaaggagatgttaccac[T/G]gaacctacagaaatacaaacaatc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN382_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN382_HUMAN | n/a | 2.58 | 1.50 | -0.42 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
