rs680454 chr3:21894683 A>T
- Sequence
ctccctccagtggctaagttagca[A/T]ccacagatctgaaatgtctatttt
- ASB in cell types
- pancreas upper lobe of left lung A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 1.04 | -0.88 | 1.17 | |||
| upper lobe of left lung | 1.19 | -0.56 | 1.00 | |||
| A549 (lung carcinoma) | 0.09 | 0.39 | 1.97 |
Items per page:
1 – 3 of 3