rs680673 chr11:95069880 A>T
- Sequence
gcaggtggcgaagggaggtgaggt[A/T]tatttattaaatgggaccgagtgg
- ASB in cell types
- K562 (myelogenous leukemia) erythroid progenitors foreskin keratinocyte aortic adventitial fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.24 | 0.96 | 2.00 | |||
| erythroid progenitors | n/a | 2.59 | 2.50 | |||
| foreskin keratinocyte | n/a | 0.35 | 2.50 | |||
| aortic adventitial fibroblasts | -1.37 | 1.66 | 1.00 |
Items per page:
1 – 4 of 4