rs6811952 chr4:5998380 T>A
- Sequence
acattattgacactgctttttttt[T/A]aaaagctcttgcttgctgctggag
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 2.10 | 2.50 | |||
| PC9 (lung adenocarcinoma) | -0.95 | 1.39 | 2.00 |
Items per page:
1 – 2 of 2