rs681238 chr6:44238108 A>C
- Sequence
cccgcgcgccccctggcgggcgtc[A/C]ggccccactgctctgcgcttctgc
- ASB in cell types
- foreskin keratinocyte MM1.S (plasma cell myeloma) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.42 | 2.17 | |||
| MM1.S (plasma cell myeloma) | 1.93 | -0.71 | 1.37 | |||
| epidermal keratinocytes | 0.40 | 1.84 | 2.00 |
Items per page:
1 – 3 of 3