rs6822083 chr4:12632887 C>A
- Sequence
attgcaaatagcgtctatgcttag[C/A]aggcacatttatacgtagggttag
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.07 | 1.28 | 1.11 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), age at death with kuru exposure, body mass index (bmi), fasting blood glucose, fasting insulin, homa-ir, hypertension (early onset hypertension), partial epilepsy