rs6825431 chr4:94390970 T>A
- Sequence
gatctcacaatttgtatttttatt[T/A]tgtttccttttccctttttgacac
- ASB in cell types
- neural cell VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.07 | 0.91 | 1.22 | |||
| VCaP (prostate carcinoma) | 1.43 | n/a | 2.33 |
Items per page:
1 – 2 of 2