rs682642 chr4:134753528 G>A
- Sequence
gtacaatcaaactttacttggttg[G/A]tgagcatgttgaattttggagctc
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.74 | 1.40 | 2.00 | |||
| A549 (lung carcinoma) | -1.47 | 1.28 | 1.33 |
Items per page:
1 – 2 of 2