rs685724 chr1:67689010 T>C
- Sequence
taggaagtgactaagaatccaagg[T/C]tgtgcattttgcagaaccattttt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZNF24_HUMAN RING2_HUMAN EMSY_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | -0.00 | 1.36 | 1.58 | n/a | n/a | |||
| RING2_HUMAN | n/a | 2.48 | 2.00 | n/a | n/a | |||
| EMSY_HUMAN | n/a | 1.92 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, arthritis including non-rheumatoid, ldl cholesterol change with statins