rs686393 chr1:30417740 T>C
- Sequence
tcctcaagcaagtgaagcccgcta[T/C]agcctcagggcctttgcacatgct
- ASB in cell types
- BT-474 (breast invasive ductal carcinoma)
- ASB for transcription factors
- AP2C_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2C_HUMAN | 1.79 | -1.38 | 1.50 | -1.47 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, alzheimers disease, hdl cholesterol, prop taste detection threshold, triglycerides