rs6866416 chr5:67221648 A>G
- Sequence
tgtcatgtggaaagctgaagtcac[A/G]gacaacatattgcagatttatttc
- ASB in cell types
- GM12878 (female B-cells) monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -3.91 | 2.14 | 2.50 | -0.34 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
