rs6877169 chr5:170604266 G>A
- Sequence
tcggttgccagtgactgaaaccca[G/A]ctgaaatggacttgggaacatact
- ASB in cell types
- foreskin keratinocyte heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -3.05 | 2.13 | 2.50 | |||
| heart left ventricle | 1.52 | -1.57 | 1.00 |
Items per page:
1 – 2 of 2