rs687852 chr16:22727362 A>G
- Sequence
caactgtcttggacactattacca[A/G]gttgcaccttaaattttaagtgag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.47 | -0.15 | 1.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), arthritis including non-rheumatoid, biploar disorder (bipolar schizoaffective disorder), fasting blood glucose, hip bone mineral density (bmd), hypertension (early onset hypertension), neuroticism, partial epilepsy