rs688540 chr1:47536775 G>A
- Sequence
ctccaatactactgaaatgtttgc[G/A]caatcttgaagcatttatttaaaa
- ASB in cell types
- HEK293 (embryonic kidney) cranial neural crest cells HEK293T (embryonic kidney)
- ASB for transcription factors
- COT1_HUMAN PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | -2.09 | 2.17 | 2.00 | n/a | No Hit | |||
| PKNX1_HUMAN | n/a | 0.60 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2