rs6889271 chr5:42949220 G>T
- Sequence
atgcactaaaattagtacacaaat[G/T]aaaaacgataaaattttagaaagt
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.25 | 0.62 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, hdl cholesterol, hdl cholesterol change with statins, height, infant head circumference, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Stomach, Testis, Whole_Blood