rs6892740 chr5:94968681 A>C
- Sequence
ctgttttgttgcaatattgcataa[A/C]accacaagatggcaatagtactta
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) neutrophils HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.65 | 2.50 | |||
| K562 (myelogenous leukemia) | -0.14 | 0.62 | 1.99 | |||
| neutrophils | -0.07 | 2.19 | 1.50 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.73 | 1.26 | 2.00 |
Items per page:
1 – 4 of 4