rs689662 chr3:16372691 G>A
- Sequence
tttcccaaatgcgtaatgaaccag[G/A]aaaaggggaaggccaaaggagaag
- ASB in cell types
- periferal blood macrophages GM12891 (male B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 0.50 | 2.42 | 2.00 | |||
| GM12891 (male B-cells) | 1.74 | -1.43 | 1.33 |
Items per page:
1 – 2 of 2