rs6905862 chr6:31159825 G>A
- Sequence
atactcccatcagattggatggat[G/A]gtcgtggtccagaccttcatcttc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.49 | n/a | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), asthma, chronic kidney disease, comorbid depressive syndrome and alcohol dependence, parkinsons disease, prop taste detection threshold, serum creatinine, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood