rs6908272 chr6:11172412 T>C
- Sequence
agtcaacaaacatgaattgaactc[T/C]ttgtgttagttaggtagtgagatg
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.25 | 2.25 | |||
| K562 (myelogenous leukemia) | 0.55 | -0.62 | 3.00 |
Items per page:
1 – 2 of 2