rs6918008 chr6:105596474 T>C
- Sequence
gctgagaactaggatactttacta[T/C]gtctgtgattgaaatgcccattga
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.47 | 0.68 | 1.21 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, fasting blood glucose, microalbuminuria, parkinsons disease, urinary albumin-to-creatinine ratio