rs692813 chr11:64391234 G>A
- Sequence
gcgcctgtagtcccagctacttgg[G/A]aggctgaggcaggaaaaccacatg
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- PBX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX1_HUMAN | -1.62 | 1.90 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Muscle_Skeletal, Nerve_Tibial, Whole_Blood