rs6944579 chr7:101328323 A>G
- Sequence
ctgggcttgcaactttatacattc[A/G]cagaaagacttgcttttatttatt
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN394_HUMAN ZF64A_HUMAN ZN781_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN394_HUMAN | 2.11 | n/a | 2.00 | n/a | No Hit | |||
| ZF64A_HUMAN | 2.20 | n/a | 2.00 | n/a | n/a | |||
| ZN781_HUMAN | 1.92 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP asthma, college completion, eye color, hypertension (early onset hypertension), late onset alzheimers disease, years of education
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid