rs694511 chr9:133955963 G>A
- Sequence
tgctggaggcccccgctccgggga[G/A]ctctcagacgggcagccagcacct
- ASB in cell types
- GM12878 (female B-cells) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.33 | n/a | 1.33 | |||
| pancreas | 1.44 | -1.34 | 1.00 |
Items per page:
1 – 2 of 2